About Us
Contact Us
Login to Protein Lounge!
1 2 3 4 56 7
  1. Genomic Analysis Reveals Dynamic Remodeling of RPE Cells During Chick Development.
    Protein Lounge Databases.
  1. The chemokine SDF1 controls multiple steps of myogenesis through atypical PKCζ.
    Mouse PKCζ (accession number, NM_001039079) small interfering RNA (siRNA) (5′-AAC TGC AAG CTG CTG GTC CAT-3′) and non-homologous (nh) siRNA (5′-AAT TCT CCG AAC GTG TCA CGT-3′) were designed using the Protein Lounge siRNA database.
  1. Integrated Molecular Signature of Disease: Analysis of Influenza Virus-Infected Macaques through Functional Genomics and Proteomics.
    Pathway Builder Tool Fig 4A &4B.
  1. Analysis of the RPE transcriptome reveals dynamic changes during the development of the outer blood-retinal barrier.
    Protein Lounge used to determine the membership of proteins to pathways.
  1. Conservation of the BRCA1 Gene.
    Thesis Paper. Protein Lounge used to help build the BRCA1 pathway (Fig3).
  1. Transcriptional Regulatory Networks via Gene Ontology and Expression Data.
    Protein Lounge Database used to help created GenDat database.
  1. Cell Cycle Regulation
    Presentation. Several slides from Protein Lounge Pathway Builder are shown.
  1. Thermoscientific SMAD3 antibody page
    ProteinLounge database info on SMAD3 used on page.
  1. Nectin-like proteins mediate axon–Schwann cell interactions along the internode and are essential for myelination.
    Targeted sequences within the first IgG domain of Necl-4 were designed using Easy siRNA.
  1. Nodes of Ranvier and axon initial segments are ankyrin G–dependent domains that assemble by distinct mechanisms
    shRNA sequences to knock down the expression of ankyrin G were designed using Easy siRNA.
  1. The role of PI3K/AKT signaling on the formation of the epaxial myotome of the mouse (mus musculus) embryo
    Protein Lounge AKT signaling pathway used in figure (Fig 7).
  1. RNAi reagent design
    Van Zandt KE. Dissertation. A siRNA target sequence (aagcaagcgtaatctccaggga, 225-275) was identified in mouse STAT1 (NM-009283) using the Protein Lounge on-line siRNA Database.
  1. Selective Raf inhibition in cancer therapy
    ProteinLounge mentioned as an expert system focused on pathway analysis.
  1. Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale
    Protein Lounge database used to determine protein ontology.
    Julia Diegmann. Thesis. Modified version of CD27 pathway used (Fig 26).
  1. Pathguide: a Pathway Resource List
    Estimates ProteinLounge database size and popularity in Figure 1.
  1. Sexual experience in female rodents: Cellular mechanisms and functional consequences
    Pathway Builder used to make a schematic diagram of signaling pathways that could result in changes to cellular plasticity as a function of sexual experience.
  1. Modulation of the growth hormone–insulin-like growth factor (GH–IGF) axis by pharmaceutical, nutraceutical and environmental xenobiotics: An emerging role for xenobiotic-metabolizing enzymes and the transcription factors regulating their expression. A review
    Scarth JP. Xenobiotica 36: 119–218. Protein Lounge mentioned as having particularly good diagrams of GH, the IGFs, and Insulin.
  1. Host-Specific Response to HCV Infection in the Chimeric SCID-beige/Alb-uPA Mouse Model: Role of the Innate Antiviral Immune Response.
    Pathway Builder used to help design an IFN signaling pathway (Fig7).
1 2 3 4 56 7