Overview	Print
Parameter
Validataion Method
Western Blot Validation of siRNA Targets

Protein Lounge has created a comprehensive siRNA database that contains siRNA targets against all known mRNA sequences throughout a variety of organisms. The database has also been subdivided into folders for siRNA against Kinases, Phosphatases, Transcription Factors and Disease genes in order to provide a total solution for your RNAi research needs. All siRNA targets in the database are linked to Protein Lounges web-based siRNA cloning tool that allows users to chose from a wide variety of vectors and also search for specific repeat patterns in complete genomes. The tool retrieves results fast and displays them in intuitive and insightful interfaces. The program output is ranked by the degree of specificity of the predicted siRNAs. All genes in the siRNA database are also linked to our Protein and Pathway database, giving you detailed information about the genes which the siRNA are against.

Small interfering RNAs (siRNA) represent a true "breakthrough technology" by which gene expression can be selectively silenced. dsRNA (doublestranded RNA) that are homologous in sequence to a gene's mRNA when introduced inside a cell suppress that gene's expression through a process known as RNAi (RNA interference). The basic mechanism behind RNAi is the breaking of a dsRNA matching a specific gene sequence into short pieces of siRNA. These siRNAs are 21-23nt dsRNA duplexes with symmetric 2-3nt 3' overhangs and 5'-phosphate and 3'-hydroxyl groups, which post-transcriptionally silences a gene through mRNA inhibition or degradation without producing a non-specific cytotoxic response. Interference of gene expression by siRNA is now recognized as a naturally occurring biological strategy for silencing alleles during development in plants, invertebrates, and vertebrates. It is believed that the small size of the siRNAs, as compared with dsDNA, prevents activation of the dsRNA-inducible interferon system in mammalian cells. This avoids the non-specific phenotypes normally produced by dsRNA (>30 base pairs). Similar to dsRNA, siRNAs inhibit gene expression by inducing RNAi.

The mechanism for mRNA silencing by siRNA involves the chopping of long dsRNA into smaller pieces of a defined length corresponding to both sense and antisense strands of the target gene by the Rnase-III (Ribonuclease-III) family member, Dicer in an ATP-dependent reaction. Dicer chops dsRNA into two classes of smaller RNAs-miRNAs (microRNAs) and siRNAs-that are around 21-23nts in length. Dicer delivers these siRNAs to a group of proteins called the RISC (RNA-Inducing Silencing Complex), which uses the antisense strand of the siRNA to bind to and degrade the corresponding mRNA, resulting in gene silencing. There is a strict requirement for the siRNA to be 5' phosphorylated to enter into RISC, and siRNAs that lack a 5' phosphate are rapidly phosphorylated by an endogenous kinase. Although the uptake of siRNAs by RISC is independent of ATP, the unwinding of the siRNA duplex requires ATP. Once unwound, the single-stranded antisense strand guides RISC to mRNA that has a complementary sequence, which results in the endonucleolytic cleavage of the target mRNA. The target mRNA is cleaved at a single site in the centre of the duplex region between the guide siRNA and the target mRNA, 10nt from the 5' end of the siRNA for degradation. Endogenously expressed siRNAs have not been found in mammals. However, the related short miRNAs are produced by Dicer cleavage, which causes translational repression. Chemically synthesized siRNAs that are introduced into cells bypass the 'dicing' step and are incorporated into the RISC for targeted mRNA degradation. Perfect duplex hairpin RNA can be cleaved by Dicer into siRNAs. Designer siRNAs are also transcribed as stem-loop RNA precursors, which are encoded by an expression vector. However, after cleavage by dicer, these appear to be treated exactly like siRNAs, leading to the specific degradation of homologous mRNAs.

Parameters

The parameters for the siRNA Database are based on the methods developed for siRNA prediction by Dr. Thomas Tuschl (Max-Planck Institut).

BEST TARGET: The 'Best Target' for siRNA is nearest to the mRNA start sequence. Those siRNA targets which are nearest to the start sequence produce a better 'Knock-Down' due to cleavage of a great segment of the mRNA.

All siRNA targets have been screened to remove any siRNA which shares homology with other sequences, thus producing targets which are specific to the gene of interest.

Target Selection Method:

Target Size:	19-22 Nucleotides
Nucleotide target from 5' and 3':	50 (Optimum). The search for target start after 50 nucleotide for sequences size more than 200. Ignored for sizes less than 200 nucleotide.
Nucleotide Target For siRNA:	Either "AA" (Optimum) or "T"
G+C Content:	47-51% Optimum (10-90% are also taken in account if optimum fails)
'A' Repeats:	<4 (i.e motif will have less then or equal to 4 A's repeats)
'T' Repeats:	<4 (i.e motif will have less then or equal to 4 T's repeats)
'G' Repeats:	<3 (i.e motif will have less then or equal to 3 G's repeats)
'C' Repeats:	<3 (i.e motif will have less then or equal to 3 C's repeats)

The siRNA targets which are listed in the Protein Lounge siRNA database have been statistically validated, which means that we have tested many of targets which have been generated in our database through experimental methods to see if these targets 'knocked-down' mRNA levels. The results below indicate that the siRNA targets which we have tested produced sufficient 'knock-down' of mRNA levels. Based on the results below, the rest of the targets in our database have been validated through statistical comparisons. We selected the 'Best Target' for our siRNA database for the genes shown below. The 'Best Target' for each of these genes was cloned into a U6 promoter siRNA plasmid (Imgenex, San Diego, CA). These plasmids were then transfected into 293 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). The cells were harvested after 48 hours. The lysates from the cells was run on Western Blot to measure the level of protein expression for each of the genes which siRNA was generated against. The reduced protein level which occurred in each of the cells indicates that the siRNA targets chosen from the Protein Lounge siRNA database function well in inhibiting the mRNAs for those proteins. In many cases the siRNA was able to produce a knockdown of ~99%.

Western Blot Validation of siRNA Targets

-Column A (Positive Control, without siRNA) and Column B (Results after siRNA Transfection)

Gene Name: Caspase-1 (H. sapien) Best Target Sequence: taatggacaagtcaagccgca	Gene Name: Caspase-8 (H. sapien) Best Target Sequence:agcaatctgtccttcctgaag Beta-Actin used as an addition positive control
Gene Name: Caspase-9 (H. sapien) Best Target Sequence:ctaacaggcaagcagcaaagt	Gene Name: Bcl-2 (H. sapien) Best Target Sequence:ccattataagctgtcgcagag
Gene Name: IKBalpha (H. sapien) Best Target Sequence: ggctttcctcaacttccagaa	Gene Name: IKKalpha (H. sapien) Best Target Sequence: ttaagtcttgtcgcctagagc
Gene Name: IKKbeta (H. sapien) Best Target Sequence:atgtcatccgatggcacaatc	Gene Name: IKKepsilon (H. sapien) Best Target Sequence: ggtcttcaacactaccagcta
Gene Name: IKKgamma (H. sapien) Best Target Sequence: ggagttcctcatgtgcaagtt	Gene Name: TBK1 (H. sapien) Best Target Sequence: cataagcttccttcgtccagt
Gene Name: p53 (H. sapien) Best Target Sequence: gactccagtggtaatctactg	Gene Name: Smac (H. sapien) Best Target Sequence: cagatagcacctctacctttc
Gene Name: MeCP2 (H. sapien) Best Target Sequence: aagcctttcgctctaaagtgg
	Top