Home l Register l Login l My Account  
The DEMO only allows access to the first page. To view the rest of the database, please click here to register.
If you are registered for the siRNA Database then click here to login.
 
Total Human Genes - 22864 nos
Alphabetic Listing: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Genes List For Alphabet: A Sublisting: Search:
  Option: Gene Name GenBank No.
   1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 |   
Gene Name GenBank siRNA Best Target Position More siRNA Targets Clone
1-acylglycerol-3-phosphate O-acyltransferase 2 NM_006412 cctcaaagtgtggatctatcc View Clone
1-acylglycerol-3-phosphate O-acyltransferase 3 NM_020132 ccacaacttcgagatcgactt View View Clone
101F6 NM_007022 gctcaagctataccatgctac View Clone
13CDNA73 NM_023037 caacgaactcggcaaagcttt View View Clone
1D12A NM_021981 acttctagaaagttgcaaacc View Clone
2-5-oligoadenylate synthetase 2 6971kDa (OAS2) NM_002535 gaatgtcagacactgatcgac View View Clone
2-5-oligoadenylate synthetase-like OASL NM_198213 acatcggccaactaagctgaa View Clone
20D7-FC4 NM_012066 cagcatctcactttcttctcc View Clone
24432 NM_022914 tgctgtgcatctctgagaatg View Clone
25-oligoadenylate synthetase 1 4046kDa (OAS1) NM_002534 ctacagagagacttcctgaag View View Clone
3 exoribonuclease 3HEXO NM_153332 ggatccaagttcattacctcc View View Clone
3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 XM_352961 ggagtaggacttgtgcattca View View Clone
3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like XM_166383 tatccaggagttcgctatcct View View Clone
384D8-2 NM_152299 gaaaggtaggccttactctgt View View Clone
3PAP NM_019061 atgatggaggaagtccagagt View View Clone
5-azacytidine induced gene 2 AZ2 NM_022461 gagctggaactgatgaggaaa View View Clone
5-hydroxytryptamine (serotonin) receptor 7 (adenylate NM_000872 tggcatagtgaagctccagaa View View Clone
5-hydroxytryptamine (serotonin) receptor 7 (adenylate NM_019859 tctccagaccatcacaattgg View Clone
5-methyltetrahydrofolate-homocysteine NM_002454 gcagaggacaagaggagataa View View Clone
5-nucleotidase cytosolic II-like 1 (NT5C2L1) NM_152729 aatgactggcaaacctgaacc View View Clone
5-oxoprolinase ATP-hydrolysing OPLAH XM_291266 ggatgtgcaggtgttgttcat View Clone
510-methenyltetrahydrofolate synthetase NM_006441 agaacagatttgcctccaggt View Clone
6H9A NM_004908 gaggctctcatgtctagtgat View Clone
76P NM_014444 ctgtttcaggccttcattgac View View Clone
8-oxoguanine DNA glycosylase (OGG1) nuclear gene NM_016821 gtatggacactgactcagact View View Clone
8-oxoguanine DNA glycosylase (OGG1) nuclear gene NM_016828 gaggtggctcagaaattccaa View View Clone
8-oxoguanine DNA glycosylase (OGG1) nuclear gene NM_016827 gtatggacactgactcagact View View Clone
8-oxoguanine DNA glycosylase (OGG1) nuclear gene NM_016826 gtatggacactgactcagact View View Clone
82-kD FMRP Interacting Protein 182-FIP NM_020772 actatgctgttgagcacagca View View Clone
8D6A NM_016579 ctgacaagaaactgcgcaact View Clone
a disintegrin and metalloprotease domain 32 (ADAM32) NM_145004 cttgtgtactgaaagacggag View View Clone
a disintegrin and metalloproteinase domain 11 NM_021612 cctggccgatgtgatatacaa View Clone
a disintegrin and metalloproteinase domain 12 (meltrin) NM_021641 cgaaggaagagctgatgaagt View View Clone
a disintegrin and metalloproteinase domain 17 (tumor) NM_021832 aatggcaggacttcttcactg View View Clone
a disintegrin-like and metalloprotease (reprolysin) NM_030955 gagagatttggatggctcaga View View Clone
a disintegrin-like and metalloprotease (reprolysin) NM_030957 gtggcagaaatccatcgtgaa View View Clone
a disintegrin-like and metalloprotease (reprolysin) NM_030955 ggacaaactgtcagccagttt View View Clone
a disintegrin-like and metalloprotease (reprolysin) NM_139025 atatcacagccaacctcacct View View Clone
A kinase (PRKA) anchor protein (gravin) 12 (AKAP12) NM_005100 caaagtctgtgccagaagatg View View Clone
A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9) NM_005751 caagttacgaaactccagcag View View Clone
   1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 |   
Copyright ©2004 www.Proteinlounge.com. All rights reserved.